Help & User Guide – MRIcal

Welcome to MRIcal, a powerful web-based tool for Mutational Responsive Index calculation. This guide will help you understand the steps required to use MRIcal efficiently and obtain accurate results.

Getting Started

MRIcal provides a user-friendly interface that allows researchers to calculate MRI values for their genetic sequences. Users can input their data in two ways:

• Upload a FASTA file containing nucleotide sequences.
• Enter sequences manually in the provided text box, ensuring adherence to the FASTA format.

When entering sequences manually, it is important to follow the FASTA format correctly: (Gene3 is perfect!)

>Gene1
ATGCGTACGTTAGCGTACGTAACGT
>Gene2
ATGTTGACCGTATCGTAACTGA
>Gene3
ATGTTGACCGTATCGTATCTGAGCTGA
    

Incorrect formatting may cause input rejection or inaccurate results.

Selecting the Genetic Code

MRIcal supports fifteen common genetic codes to accommodate various species and organelles. Users must select the appropriate genetic code from the dropdown menu before submitting their sequences.

Preprocessing and Validation

To ensure accuracy, MRIcal automatically validates input sequences. The system checks for:

• Presence of a valid start codon.
• Sequence length divisible by three to maintain the correct reading frame.
• A valid stop codon at the end of the sequence.
• Absence of internal stop codons that could disrupt translation.

If any sequence fails validation, MRIcal will flag it and provide the option to:

• Proceed with only valid sequences.
• Include all sequences with warnings.

Results and Output

Once the analysis is complete, MRIcal generates an Excel file containing:

• Gene ID associated with each sequence.
• MRI value representing mutational bias in codon usage.
• Synonymous Codon Score (SCS) measuring codon conservation.
• Codon Synonymous Codon Score (CSCS) evaluating individual codon contributions.

Users can download the Excel file for further analysis.

Common Errors and Troubleshooting

Error: "Invalid FASTA Format"

Solution: Ensure sequences are in uppercase letters and follow the correct FASTA format.

Error: "Sequence is not divisible by three"

Solution: Ensure the sequence length is a multiple of three to maintain proper reading frame. Failing this condition will result in an invalid sequence under the "Divisible By Three" column.

Error: "No valid start codon detected"

Solution: Ensure the sequence starts with a valid start codon (e.g., ATG). Sequences failing this check will be marked under the "Initiate With Start Codon" column.

Error: "No valid stop codon found"

Solution: Ensure the sequence ends with a valid stop codon (TAA, TAG, or TGA). If missing, it will be flagged under the "End with a Stop Codon" column.

Error: "Internal stop codons detected"

Solution: Remove internal stop codons as they cause premature translation termination. If present, the sequence will be marked under the "No Internal Stop Codon" column.

Access MRIcal

Start your analysis now at MRIcal Web Server.