Welcome to MRIcal, a powerful web-based tool for Mutational Responsive Index calculation. This guide will help you understand the steps required to use MRIcal efficiently and obtain accurate results.
MRIcal provides a user-friendly interface that allows researchers to calculate MRI values for their genetic sequences. Users can input their data in two ways:
When entering sequences manually, it is important to follow the FASTA format correctly: (Gene3 is perfect!)
>Gene1 ATGCGTACGTTAGCGTACGTAACGT >Gene2 ATGTTGACCGTATCGTAACTGA >Gene3 ATGTTGACCGTATCGTATCTGAGCTGA
Incorrect formatting may cause input rejection or inaccurate results.
MRIcal supports fifteen common genetic codes to accommodate various species and organelles. Users must select the appropriate genetic code from the dropdown menu before submitting their sequences.
To ensure accuracy, MRIcal automatically validates input sequences. The system checks for:
If any sequence fails validation, MRIcal will flag it and provide the option to:
Once the analysis is complete, MRIcal generates an Excel file containing:
Users can download the Excel file for further analysis.
Error: "Invalid FASTA Format"
Solution: Ensure sequences are in uppercase letters and follow the correct FASTA format.
Error: "Sequence is not divisible by three"
Solution: Ensure the sequence length is a multiple of three to maintain proper reading frame. Failing this condition will result in an invalid sequence under the "Divisible By Three" column.
Error: "No valid start codon detected"
Solution: Ensure the sequence starts with a valid start codon (e.g., ATG). Sequences failing this check will be marked under the "Initiate With Start Codon" column.
Error: "No valid stop codon found"
Solution: Ensure the sequence ends with a valid stop codon (TAA, TAG, or TGA). If missing, it will be flagged under the "End with a Stop Codon" column.
Error: "Internal stop codons detected"
Solution: Remove internal stop codons as they cause premature translation termination. If present, the sequence will be marked under the "No Internal Stop Codon" column.
Start your analysis now at MRIcal Web Server.